View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0313_high_3 (Length: 251)
Name: NF0313_high_3
Description: NF0313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0313_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 40201907 - 40202148
Alignment:
Q |
1 |
ccagatgatgtgtattcttattaaatgctgagcattctgtttcagggcagcaatccatcatctccaaggaagaatagtcccactgacaatggttctgggc |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40201907 |
ccagatgatgtgtattcttattaaatgctgagcattctgtttcagggcagcaatccatcttctccaaggaagaatagtcccactgacaatggttctgggc |
40202006 |
T |
 |
Q |
101 |
ttctgggtcgatggctttcctctcattaccatgggggtgtccatgatgaaagatctgtagcacgtcatactgtaaacctgctaacatcaactataaaggt |
200 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40202007 |
ttctgggtcgatggctttcttctcattaccatgggggtgtccatgatgaaagatctgtagcacgtcatactgtaaacctgctaacatcaactataaaggt |
40202106 |
T |
 |
Q |
201 |
tgatgcagatcagtctgatttaagattttgcttcagaataat |
242 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40202107 |
tgatgcagatcagtctgatttaagattttgcttcagaataat |
40202148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 144 - 236
Target Start/End: Original strand, 45086595 - 45086687
Alignment:
Q |
144 |
tgatgaaagatctgtagcacgtcatactgtaaacctgctaacatcaactataaaggttgatgcagatcagtctgatttaagattttgcttcag |
236 |
Q |
|
|
|||||||| |||||||||||| || || || ||||| || |||||||| || ||| ||||||| || || || |||||||| || |||||||| |
|
|
T |
45086595 |
tgatgaaaaatctgtagcacgccacacagtgaaccttctcacatcaacaatcaagattgatgctgagcaatcagatttaaggttctgcttcag |
45086687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1849 times since January 2019
Visitors: 2853