View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0315_low_6 (Length: 244)
Name: NF0315_low_6
Description: NF0315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0315_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 14 - 146
Target Start/End: Original strand, 3724416 - 3724548
Alignment:
| Q |
14 |
tgggtagataatacttccactttactgtaattggagctaggctttacaacctttggagcaacggaagaaacatagagnnnnnnntgtcatgaccacattt |
113 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
3724416 |
tgggtagttaacacttccactttactgtaattggagctaggctttacaacctttggagcaacgaaagaaacatagagaaaaaaatgtcatgaccacattt |
3724515 |
T |
|
| Q |
114 |
gtaaataacaaaagatgtagttaatagttatat |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3724516 |
gtaaataacaaaagatgtagttaatagttatat |
3724548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University