View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0315_low_6 (Length: 244)

Name: NF0315_low_6
Description: NF0315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0315_low_6
NF0315_low_6
[»] chr4 (1 HSPs)
chr4 (14-146)||(3724416-3724548)


Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 14 - 146
Target Start/End: Original strand, 3724416 - 3724548
Alignment:
14 tgggtagataatacttccactttactgtaattggagctaggctttacaacctttggagcaacggaagaaacatagagnnnnnnntgtcatgaccacattt 113  Q
    ||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||       ||||||||||||||||    
3724416 tgggtagttaacacttccactttactgtaattggagctaggctttacaacctttggagcaacgaaagaaacatagagaaaaaaatgtcatgaccacattt 3724515  T
114 gtaaataacaaaagatgtagttaatagttatat 146  Q
    |||||||||||||||||||||||||||||||||    
3724516 gtaaataacaaaagatgtagttaatagttatat 3724548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University