View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0316_high_4 (Length: 236)
Name: NF0316_high_4
Description: NF0316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0316_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 13473323 - 13473185
Alignment:
| Q |
1 |
ggtttgattaaaacgacagaaaataaatatatatcttatatccgaaatcaatacattcaccatgttagttgtaaatatgagaagggtcatgtgtttttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13473323 |
ggtttgattaaaacgacagaaaataaatatatatcttatatccgaaatcaatacattcaccatgttagttgtaaatatgagaagggtcgtgtgtttttgt |
13473224 |
T |
 |
| Q |
101 |
ttttaaataatatcgttgatactcgttaattttaagtat |
139 |
Q |
| |
|
|| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13473223 |
ttataaataatatcgttgatactcattaattttaagtat |
13473185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University