View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0316_low_3 (Length: 355)
Name: NF0316_low_3
Description: NF0316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0316_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 175 - 346
Target Start/End: Complemental strand, 3342855 - 3342687
Alignment:
| Q |
175 |
tttgtcctctcttcaattctctttctttgtttatgtattgtgatgagaggttaacgtttgggattcaaatgtttatggattatgtttgtctataggtggt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3342855 |
tttgtcctctcttcaattctctttctttgtttatgtattgtgataagaggttaacgtttgggattcaaatgtttatggattatgtttgtctata---ggt |
3342759 |
T |
 |
| Q |
275 |
tgtgaaatattaggattgttattgatatggtggatgtgtaagaaaataatgttccaaaacatgtagtataat |
346 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3342758 |
tgtgaaatagtaggattgttattgatatggtggatgtgtaagaaaataatgttccaaaacatgtagtataat |
3342687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 101 - 171
Target Start/End: Complemental strand, 3342968 - 3342898
Alignment:
| Q |
101 |
ataagataaatgtggaaatatgtttctacgtagatttaattgtaaacattatacaagataagatacttact |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3342968 |
ataagataaatgtggaaatatgtttctacgtagatttaattgtaaacattatacaagataagatacttact |
3342898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University