View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0319_high_13 (Length: 259)

Name: NF0319_high_13
Description: NF0319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0319_high_13
NF0319_high_13
[»] chr4 (1 HSPs)
chr4 (27-250)||(43212003-43212220)


Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 27 - 250
Target Start/End: Original strand, 43212003 - 43212220
Alignment:
27 tcactgtagttgtcttggcattgcaagttggtcgctcgcttactgaaactcttttgtccgtcttttcgcatgcagctaatgccagtgccttgaagcttac 126  Q
    ||||||||||||||||||||||||||||||||||||    |||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||    
43212003 tcactgtagttgtcttggcattgcaagttggtcgct----tactgaaactctt--gtccgtcttttcgcatgcagctaatgccagtgccttgaagcttac 43212096  T
127 ctgtgaacttctccgggtttttgttacaggttcatccatatgaaaagagaaacacattgatgcttgctcaagactatgatttgcatatattccatgccat 226  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43212097 ctgtgaacttctccgggtttttgttacaggttcatccatatgaaaagagaaacacattgatgcttgctcaagactatgatttgcatatattccatgccat 43212196  T
227 gttgtttttgacataacctctctg 250  Q
     |||||||||||||||||| ||||    
43212197 attgtttttgacataacctttctg 43212220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 740 times since January 2019
Visitors: 2787