View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0319_low_15 (Length: 261)
Name: NF0319_low_15
Description: NF0319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0319_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 5 - 240
Target Start/End: Complemental strand, 44695495 - 44695258
Alignment:
Q |
5 |
gagcagcacagaggacactttttctttgttttgatttcaccttttaaatacattgatctcaaatctttttggagtctttgaggaa--attaattaatgtt |
102 |
Q |
|
|
||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
44695495 |
gagcatcacaaaggacactttttctttgttttgatttcaccttttaaatacattgatctcaaatctttttggagtctttgaggaattattaattaatgtt |
44695396 |
T |
 |
Q |
103 |
ttgtacggcaggaatggtgaaactttgcctcaaatatcaaaggaatacataagagtaaagtaagtggtgcaagttagcatgcatggctgatcgatccatc |
202 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44695395 |
ttgtacggcaggaatggtgaaactttgcctcaaatatcaaaggaatacataagagtaaagtaagtggtgcaagttagcatgcatggctgatcgatccatc |
44695296 |
T |
 |
Q |
203 |
atatcaacattacatttttccattttgccatgatgatg |
240 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
44695295 |
atatcaacattacatttttccattttgccatgatgatg |
44695258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University