View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0319_low_17 (Length: 259)
Name: NF0319_low_17
Description: NF0319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0319_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 27 - 250
Target Start/End: Original strand, 43212003 - 43212220
Alignment:
Q |
27 |
tcactgtagttgtcttggcattgcaagttggtcgctcgcttactgaaactcttttgtccgtcttttcgcatgcagctaatgccagtgccttgaagcttac |
126 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43212003 |
tcactgtagttgtcttggcattgcaagttggtcgct----tactgaaactctt--gtccgtcttttcgcatgcagctaatgccagtgccttgaagcttac |
43212096 |
T |
 |
Q |
127 |
ctgtgaacttctccgggtttttgttacaggttcatccatatgaaaagagaaacacattgatgcttgctcaagactatgatttgcatatattccatgccat |
226 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43212097 |
ctgtgaacttctccgggtttttgttacaggttcatccatatgaaaagagaaacacattgatgcttgctcaagactatgatttgcatatattccatgccat |
43212196 |
T |
 |
Q |
227 |
gttgtttttgacataacctctctg |
250 |
Q |
|
|
|||||||||||||||||| |||| |
|
|
T |
43212197 |
attgtttttgacataacctttctg |
43212220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University