View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0319_low_22 (Length: 223)

Name: NF0319_low_22
Description: NF0319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0319_low_22
NF0319_low_22
[»] chr5 (2 HSPs)
chr5 (101-169)||(25565579-25565647)
chr5 (172-210)||(25565674-25565712)


Alignment Details
Target: chr5 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 101 - 169
Target Start/End: Original strand, 25565579 - 25565647
Alignment:
101 agtatcaaattgtaattttgcttattcgatgaatattatcattttggaatctattgccaaatttaaatt 169  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||    
25565579 agtatcaaattgtaattttgcttattcaatgaatattatcattttggaatttattgccaaatttaaatt 25565647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 172 - 210
Target Start/End: Original strand, 25565674 - 25565712
Alignment:
172 tatgtggaatcttcatgcatgttaatatcgtctctgctc 210  Q
    |||||||||||||||||||||||||||||||| ||||||    
25565674 tatgtggaatcttcatgcatgttaatatcgtccctgctc 25565712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 653 times since January 2019
Visitors: 2783