View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0319_low_22 (Length: 223)
Name: NF0319_low_22
Description: NF0319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0319_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 101 - 169
Target Start/End: Original strand, 25565579 - 25565647
Alignment:
Q |
101 |
agtatcaaattgtaattttgcttattcgatgaatattatcattttggaatctattgccaaatttaaatt |
169 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
25565579 |
agtatcaaattgtaattttgcttattcaatgaatattatcattttggaatttattgccaaatttaaatt |
25565647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 172 - 210
Target Start/End: Original strand, 25565674 - 25565712
Alignment:
Q |
172 |
tatgtggaatcttcatgcatgttaatatcgtctctgctc |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
T |
25565674 |
tatgtggaatcttcatgcatgttaatatcgtccctgctc |
25565712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University