View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0320_high_10 (Length: 222)

Name: NF0320_high_10
Description: NF0320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0320_high_10
NF0320_high_10
[»] chr3 (1 HSPs)
chr3 (1-36)||(43934876-43934911)


Alignment Details
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 43934876 - 43934911
Alignment:
1 aaggacctgagtttgtttctgtttgttcaatttggg 36  Q
    ||||||||||||||||||||||||||||||||||||    
43934876 aaggacctgagtttgtttctgtttgttcaatttggg 43934911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University