View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0320_high_11 (Length: 220)
Name: NF0320_high_11
Description: NF0320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0320_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 71 - 198
Target Start/End: Original strand, 32007265 - 32007392
Alignment:
Q |
71 |
ttatgtttttcctcttaagtgtgtacgtcattcaagtatacgtgcttgagttgattttgtagagtgttttcattctttgtgttgcctactagaggttctc |
170 |
Q |
|
|
||||| |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
32007265 |
ttatggttttcctcttaagtgtgtacttcattcaagtatacctgcttgagttgattttggagagtgttttcagtctttgtgttgcctactagaggttctc |
32007364 |
T |
 |
Q |
171 |
ctccttgttttatttttcctagtcgttg |
198 |
Q |
|
|
|| ||||||||||||||| |||| |||| |
|
|
T |
32007365 |
ctacttgttttatttttcatagtggttg |
32007392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 28 - 75
Target Start/End: Original strand, 32007074 - 32007121
Alignment:
Q |
28 |
ataccaccgttattgatcaattggtaaatatgactattttctcttatg |
75 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
32007074 |
ataccaccgttattgatcaattggtaaatatgactaatttctcttatg |
32007121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 603 times since January 2019
Visitors: 2779