View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0320_low_16 (Length: 220)

Name: NF0320_low_16
Description: NF0320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0320_low_16
NF0320_low_16
[»] chr2 (2 HSPs)
chr2 (71-198)||(32007265-32007392)
chr2 (28-75)||(32007074-32007121)


Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 71 - 198
Target Start/End: Original strand, 32007265 - 32007392
Alignment:
71 ttatgtttttcctcttaagtgtgtacgtcattcaagtatacgtgcttgagttgattttgtagagtgttttcattctttgtgttgcctactagaggttctc 170  Q
    ||||| |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||    
32007265 ttatggttttcctcttaagtgtgtacttcattcaagtatacctgcttgagttgattttggagagtgttttcagtctttgtgttgcctactagaggttctc 32007364  T
171 ctccttgttttatttttcctagtcgttg 198  Q
    || ||||||||||||||| |||| ||||    
32007365 ctacttgttttatttttcatagtggttg 32007392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 28 - 75
Target Start/End: Original strand, 32007074 - 32007121
Alignment:
28 ataccaccgttattgatcaattggtaaatatgactattttctcttatg 75  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||    
32007074 ataccaccgttattgatcaattggtaaatatgactaatttctcttatg 32007121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 513 times since January 2019
Visitors: 2773