View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0320_low_18 (Length: 201)

Name: NF0320_low_18
Description: NF0320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0320_low_18
NF0320_low_18
[»] chr2 (1 HSPs)
chr2 (116-157)||(38455204-38455245)


Alignment Details
Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 116 - 157
Target Start/End: Complemental strand, 38455245 - 38455204
Alignment:
116 gatggaacaaacgcaccattgatgttgcaccctatcattcat 157  Q
    ||||||||||||||||||||||||||||||||||||||||||    
38455245 gatggaacaaacgcaccattgatgttgcaccctatcattcat 38455204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University