View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0320_low_2 (Length: 457)
Name: NF0320_low_2
Description: NF0320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0320_low_2 |
 |  |
|
[»] scaffold0016 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 22 - 366
Target Start/End: Original strand, 6354184 - 6354554
Alignment:
Q |
22 |
gtgtgtttaatcttgtcaaaccaaaggaggaaacttttagtaattttagaggctaacgttattgggttggaaaacactttgtaaacaccttgg-tagtga |
120 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
T |
6354184 |
gtgtgtttaatcttgtcaaatcaaaggaggaaacttttagtaattttagaggctaacgttattgggttggaaaacactttgtaaacactttgggtagtga |
6354283 |
T |
 |
Q |
121 |
gatttcattagaggaaggat------attgacgagtttggtagcaaaaatggtggaaatcggctctttgaagaggtgtttcatgaataactccatcgatc |
214 |
Q |
|
|
||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6354284 |
gatctcattagaggaaggatcaaaggattgacgagtttggtagcaaaaatggtggaaatcggctctttgaagaggtgtttcatgaataactccatcgatc |
6354383 |
T |
 |
Q |
215 |
ttttcctattttacgatttgcggatgatacnnnnnnnatttgtgaagggaattgagagaatttatggtgtcttaaatctgttactagaatctttgcattg |
314 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6354384 |
ttttcctattttacgatttgcggatgatactttttttatttgtgaagggaattgagagaatttatggtgtcttaaatctgttactagaatctttgcattg |
6354483 |
T |
 |
Q |
315 |
atttcggg-------------------aaagtaatatttttggtttgaatattaacgatgattttttgatg |
366 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6354484 |
atttcgggtttgaaggcgactttgcaaaaagtaatatttttggtttgaatattaacgatgattttttgatg |
6354554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 83 - 140
Target Start/End: Complemental strand, 3278261 - 3278204
Alignment:
Q |
83 |
ttgggttggaaaacactttgtaaacaccttgg-tagtgagatttcattagaggaaggat |
140 |
Q |
|
|
||||||||||||||| |||||||||||||||| |||||||||||||||| |||| |||| |
|
|
T |
3278261 |
ttgggttggaaaaca-tttgtaaacaccttggatagtgagatttcattataggacggat |
3278204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 86 - 141
Target Start/End: Original strand, 28770613 - 28770668
Alignment:
Q |
86 |
ggttggaaaacactttgtaaacaccttgg-tagtgagatttcattagaggaaggata |
141 |
Q |
|
|
|||||||||||| |||||||||||||||| ||||||||| ||||||| |||||||| |
|
|
T |
28770613 |
ggttggaaaaca-tttgtaaacaccttgggtagtgagatctcattagctgaaggata |
28770668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 83 - 130
Target Start/End: Complemental strand, 37782124 - 37782077
Alignment:
Q |
83 |
ttgggttggaaaacactttgtaaacaccttgg-tagtgagatttcatta |
130 |
Q |
|
|
||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
T |
37782124 |
ttgggttggaaaaca-tttgtaaacaccttgggtagtgagatttcatta |
37782077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 99 - 141
Target Start/End: Original strand, 31513184 - 31513227
Alignment:
Q |
99 |
tttgtaaacaccttgg-tagtgagatttcattagaggaaggata |
141 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
31513184 |
tttgtaaacaccttgaatagtgagatttcattagaggaaggata |
31513227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 103 - 141
Target Start/End: Complemental strand, 30900108 - 30900069
Alignment:
Q |
103 |
taaacaccttgg-tagtgagatttcattagaggaaggata |
141 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
30900108 |
taaacaccttgggtagtgagatttcattagaggaaggata |
30900069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 85 - 140
Target Start/End: Original strand, 102332 - 102387
Alignment:
Q |
85 |
gggttggaaaacactttgtaaacaccttggta-gtgagatttcattagaggaaggat |
140 |
Q |
|
|
||||||||||||| |||| ||||||||||||| || |||||| |||||||||||||| |
|
|
T |
102332 |
gggttggaaaaca-tttgaaaacaccttggtaagtaagattttattagaggaaggat |
102387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 86 - 130
Target Start/End: Original strand, 33721398 - 33721441
Alignment:
Q |
86 |
ggttggaaaacactttgtaaacaccttggtagtgagatttcatta |
130 |
Q |
|
|
|||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
T |
33721398 |
ggttgggaaaca-tttgtaaacacctttgtagtgagatttcatta |
33721441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 447 times since January 2019
Visitors: 2762