View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0320_low_4 (Length: 396)
Name: NF0320_low_4
Description: NF0320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0320_low_4 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 169 - 396
Target Start/End: Original strand, 42951467 - 42951694
Alignment:
| Q |
169 |
agaggattccaacccgaactttactatctaattttaatcaataatttcttaatccaccacataaaatgtgatttttaattattgaaaacacgtttttgat |
268 |
Q |
| |
|
||||||| |||||| |||||||||||| ||||||||||| ||||||||||||||||| ||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
42951467 |
agaggatcccaacc-gaactttactatttaattttaatcgataatttcttaatccactacataaagtgtgatttttaattattggaaacacgtttttgat |
42951565 |
T |
 |
| Q |
269 |
tatgtattttattttcgcagttttgagcatatatgaggtagattgagaaatttccttttaagagacaacacataattttagtgtgtatttagataaacgg |
368 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42951566 |
tatgtattttatttttgcagttttgagcatatatgaggtagattgagaaatttccttttaagagacaacacataattttagtgtgtatttagataaacgg |
42951665 |
T |
 |
| Q |
369 |
taagttagg-aaaaaatgtgggacttcat |
396 |
Q |
| |
|
||||||||| ||||||||||||||||||| |
|
|
| T |
42951666 |
taagttaggaaaaaaatgtgggacttcat |
42951694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 6 - 47
Target Start/End: Original strand, 38455204 - 38455245
Alignment:
| Q |
6 |
atgaatgatagggtgcaacatcaatggtgcgtttgttccatc |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38455204 |
atgaatgatagggtgcaacatcaatggtgcgtttgttccatc |
38455245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University