View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0320_low_4 (Length: 396)

Name: NF0320_low_4
Description: NF0320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0320_low_4
NF0320_low_4
[»] chr3 (1 HSPs)
chr3 (169-396)||(42951467-42951694)
[»] chr2 (1 HSPs)
chr2 (6-47)||(38455204-38455245)


Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 169 - 396
Target Start/End: Original strand, 42951467 - 42951694
Alignment:
169 agaggattccaacccgaactttactatctaattttaatcaataatttcttaatccaccacataaaatgtgatttttaattattgaaaacacgtttttgat 268  Q
    ||||||| |||||| |||||||||||| ||||||||||| ||||||||||||||||| ||||||| |||||||||||||||||| |||||||||||||||    
42951467 agaggatcccaacc-gaactttactatttaattttaatcgataatttcttaatccactacataaagtgtgatttttaattattggaaacacgtttttgat 42951565  T
269 tatgtattttattttcgcagttttgagcatatatgaggtagattgagaaatttccttttaagagacaacacataattttagtgtgtatttagataaacgg 368  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42951566 tatgtattttatttttgcagttttgagcatatatgaggtagattgagaaatttccttttaagagacaacacataattttagtgtgtatttagataaacgg 42951665  T
369 taagttagg-aaaaaatgtgggacttcat 396  Q
    ||||||||| |||||||||||||||||||    
42951666 taagttaggaaaaaaatgtgggacttcat 42951694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 6 - 47
Target Start/End: Original strand, 38455204 - 38455245
Alignment:
6 atgaatgatagggtgcaacatcaatggtgcgtttgttccatc 47  Q
    ||||||||||||||||||||||||||||||||||||||||||    
38455204 atgaatgatagggtgcaacatcaatggtgcgtttgttccatc 38455245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University