View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0320_low_5 (Length: 366)
Name: NF0320_low_5
Description: NF0320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0320_low_5 |
 |  |
|
[»] scaffold0300 (5 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0300 (Bit Score: 100; Significance: 2e-49; HSPs: 5)
Name: scaffold0300
Description:
Target: scaffold0300; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 30 - 169
Target Start/End: Complemental strand, 2530 - 2391
Alignment:
Q |
30 |
aatatgttgaaaatttgaaagaaattaactcatatgcttggggtgctgagatgttggcatatttgtatcaaggtatgaaggattggaagaaaaggggtaa |
129 |
Q |
|
|
||||| ||||||||||| ||||| ||||||||||||||||||| |||| ||||||||||||| |||||||||||||||| ||||| ||||||| |||||| |
|
|
T |
2530 |
aatatattgaaaatttggaagaagttaactcatatgcttggggagctgcgatgttggcatatctgtatcaaggtatgaaagattgaaagaaaaagggtaa |
2431 |
T |
 |
Q |
130 |
gtcattagacggcttcacctgacttataatggtaagagca |
169 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
2430 |
gtcattagacggcttcacctggcttataatggtaagagca |
2391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0300; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 234 - 351
Target Start/End: Complemental strand, 2342 - 2225
Alignment:
Q |
234 |
aatagggattcttcttttctcattgtaaaggtctttatgggatcttcgatattattgtggagaaaaattagacccatgataaaccaacactagcatattt |
333 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| | ||||||||||| ||||||||||||||||| |
|
|
T |
2342 |
aatagggattcttcttttctcattgtaaaggtctttatgggatcttcaatattattgtggaggaaaatcaaacccatgataagccaacactagcatattt |
2243 |
T |
 |
Q |
334 |
gatagagtcgtttttgag |
351 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
2242 |
gatagagtcgtttttgag |
2225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0300; HSP #3
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 234 - 351
Target Start/End: Original strand, 950 - 1067
Alignment:
Q |
234 |
aatagggattcttcttttctcattgtaaaggtctttatgggatcttcgatattattgtggagaaaaattagacccatgataaaccaacactagcatattt |
333 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||| |||||||||||||||| |
|
|
T |
950 |
aatagggattcttcttttctcatagtaaaggtctttatgggatcttcgatattattgtggaggaaaatcaaacccatgataagccaacactagcatattc |
1049 |
T |
 |
Q |
334 |
gatagagtcgtttttgag |
351 |
Q |
|
|
|||||||| ||||||||| |
|
|
T |
1050 |
gatagagttgtttttgag |
1067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0300; HSP #4
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 31 - 122
Target Start/End: Original strand, 431 - 522
Alignment:
Q |
31 |
atatgttgaaaatttgaaagaaattaactcatatgcttggggtgctgagatgttggcatatttgtatcaaggtatgaaggattggaagaaaa |
122 |
Q |
|
|
|||| ||||||||||| ||||| ||||||| ||||||||||| |||| |||||||| |||| |||||||||||||||||||||||||||||| |
|
|
T |
431 |
atatattgaaaatttggaagaagttaactcttatgcttggggagctgcgatgttggaatatctgtatcaaggtatgaaggattggaagaaaa |
522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0300; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 126 - 169
Target Start/End: Original strand, 838 - 881
Alignment:
Q |
126 |
gtaagtcattagacggcttcacctgacttataatggtaagagca |
169 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
838 |
gtaagtcattggacggcttcacctgacttataatggtaagagca |
881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University