View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0321_high_16 (Length: 201)
Name: NF0321_high_16
Description: NF0321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0321_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 43 - 126
Target Start/End: Complemental strand, 17356335 - 17356252
Alignment:
Q |
43 |
tcatcatcttaaaccctctctatccatgattccgattcaaaactccacaagagcattcaatcatatgtttttactctcagaatc |
126 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
17356335 |
tcatcatcttaaaccctctctatccatgattccgattcaaaactccacaagagcattcaatcatatgtttttactctcataatc |
17356252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University