View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0321_low_21 (Length: 213)
Name: NF0321_low_21
Description: NF0321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0321_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 38448121 - 38447932
Alignment:
| Q |
1 |
gtctttttcatataagtcatagttaaaccaaatatctgtagcaattaaattgttatggtttccttcaaaatcgttctctgaagaaactggcttcttccct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38448121 |
gtctttttcatataagtcatagttaaaccaaatatctgtagcaattaagtcgttatggtttccttcaaaatcgttctccgaagaaactggcttcttccct |
38448022 |
T |
|
| Q |
101 |
tcttcatcaacaaaatttatcttcgaggaattcacgcgactagcatccaaaccttcccaattctcttctgtatatggagaaattgatcct |
190 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38448021 |
tcttcatcaacaaaatttatcttagaggaattcacgcgactagcatccaaaccttcccaattctcttctgtatatggagaaattgatcct |
38447932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 81 - 167
Target Start/End: Original strand, 53350984 - 53351070
Alignment:
| Q |
81 |
aagaaactggcttcttcccttcttcatcaacaaaatttatcttcgaggaattcacgcgactagcatccaaaccttcccaattctctt |
167 |
Q |
| |
|
|||||| ||||||||| |||| ||||||||| ||||||| || ||||| | ||| ||||||||||| || |||||||||||||||| |
|
|
| T |
53350984 |
aagaaattggcttctttcctttttcatcaaccaaatttagctcagaggagtgcacacgactagcatcgaagccttcccaattctctt |
53351070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 733 times since January 2019
Visitors: 2786