View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0321_low_22 (Length: 201)

Name: NF0321_low_22
Description: NF0321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0321_low_22
NF0321_low_22
[»] chr7 (1 HSPs)
chr7 (43-126)||(17356252-17356335)


Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 43 - 126
Target Start/End: Complemental strand, 17356335 - 17356252
Alignment:
43 tcatcatcttaaaccctctctatccatgattccgattcaaaactccacaagagcattcaatcatatgtttttactctcagaatc 126  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
17356335 tcatcatcttaaaccctctctatccatgattccgattcaaaactccacaagagcattcaatcatatgtttttactctcataatc 17356252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 679 times since January 2019
Visitors: 2783