View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0322_high_3 (Length: 308)
Name: NF0322_high_3
Description: NF0322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0322_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 9 - 249
Target Start/End: Complemental strand, 2327535 - 2327296
Alignment:
| Q |
9 |
gaagaaaatgttgtattttgagataagtctcgtaaacattattcttttcacttatatagttagttaagcacctaagtttatgctttctccaattttaagg |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2327535 |
gaagaatatgttgtattttgagataagtctcataa-cattattcttttcacttatatagttagttaagcacctaagtttatgctttgtccaattttaagg |
2327437 |
T |
 |
| Q |
109 |
tgtattagtaagacaagttttccaacatatacaaatttgtttttaccatttgattgataagtcttatcatttaatcaaatgtgatatgatataatataat |
208 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
2327436 |
tgtattagtaagacaagttttgcaacatatacaaatttgtttttaccatttgattgataagtcttatcttttaatcaaatgcgatatgatataatataat |
2327337 |
T |
 |
| Q |
209 |
atgattttgaatgggttaattctcttaaattgagtgttatc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2327336 |
atgattttgaatgggttaattctcttaaattgagtgttatc |
2327296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 264 - 302
Target Start/End: Complemental strand, 51905238 - 51905200
Alignment:
| Q |
264 |
agcacagacagagcaattcatacaagaaagagaaaagag |
302 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51905238 |
agcacggacagagcaattcatacaagaaagagaaaagag |
51905200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University