View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0322_low_11 (Length: 251)
Name: NF0322_low_11
Description: NF0322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0322_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 4410638 - 4410860
Alignment:
| Q |
1 |
tgttgtcgagaaacttcgagagacatttcatttttgtcgttcgggatacatgatccaaaagtatgataaccgatctctcatcttcgtttgaattcttctc |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4410638 |
tgttgtcgagaaacttcgagggacatttcatttttgtcgttcgagatacatgatccaagagtatgataaccgatctctcatcttcgtttgaattcttctc |
4410737 |
T |
 |
| Q |
101 |
ctccattttttgaactcgcactccgcttatgtttagtgtttattgtgtatgtgtttggtgttagtgaggaaaaattgaagagacattgtatttgtcccac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4410738 |
ctccattttttgaactcgcactccgcttatgtttagtgtttattgtgtatgtgtttggtgttagtgaggaaaaattgaagagacattgtagttgtcccac |
4410837 |
T |
 |
| Q |
201 |
atacatagtttggttggtgatct |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4410838 |
atacatagtttggttggtgatct |
4410860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 141
Target Start/End: Original strand, 20746387 - 20746457
Alignment:
| Q |
71 |
cgatctctcatcttcgtttgaattcttctcctccattttttgaactcgcactccgcttatgtttagtgttt |
141 |
Q |
| |
|
|||| |||||||||| |||||| |||||||||||||| |||||| ||||| |||| |||||||||||| |
|
|
| T |
20746387 |
cgatatctcatcttcacatgaatttttctcctccattttccgaactcacactctgcttctgtttagtgttt |
20746457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University