View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0322_low_15 (Length: 201)

Name: NF0322_low_15
Description: NF0322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0322_low_15
NF0322_low_15
[»] chr2 (1 HSPs)
chr2 (120-201)||(5484414-5484495)
[»] chr4 (1 HSPs)
chr4 (4-46)||(51905200-51905242)


Alignment Details
Target: chr2 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 120 - 201
Target Start/End: Original strand, 5484414 - 5484495
Alignment:
120 agtcacttggacttaagcttcacgaatttcgaaggaattccccttccagaccatattgggtctctccaactgttgaattacc 201  Q
    ||||||||||||||||||||||   ||||||||||||||||| ||||||| |||||||| |||||| || ||||||||||||    
5484414 agtcacttggacttaagcttcaatgatttcgaaggaattcccattccagaacatattggttctctcaaaatgttgaattacc 5484495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 4 - 46
Target Start/End: Original strand, 51905200 - 51905242
Alignment:
4 ctcttttctctttcttgtatgaattgctctgtctgtgctcctc 46  Q
    ||||||||||||||||||||||||||||||||| |||||||||    
51905200 ctcttttctctttcttgtatgaattgctctgtccgtgctcctc 51905242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 594 times since January 2019
Visitors: 2777