View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0322_low_15 (Length: 201)
Name: NF0322_low_15
Description: NF0322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0322_low_15 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 120 - 201
Target Start/End: Original strand, 5484414 - 5484495
Alignment:
| Q |
120 |
agtcacttggacttaagcttcacgaatttcgaaggaattccccttccagaccatattgggtctctccaactgttgaattacc |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||| |||||||| |||||| || |||||||||||| |
|
|
| T |
5484414 |
agtcacttggacttaagcttcaatgatttcgaaggaattcccattccagaacatattggttctctcaaaatgttgaattacc |
5484495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 4 - 46
Target Start/End: Original strand, 51905200 - 51905242
Alignment:
| Q |
4 |
ctcttttctctttcttgtatgaattgctctgtctgtgctcctc |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51905200 |
ctcttttctctttcttgtatgaattgctctgtccgtgctcctc |
51905242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 594 times since January 2019
Visitors: 2777