View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0322_low_8 (Length: 265)
Name: NF0322_low_8
Description: NF0322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0322_low_8 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 43 - 265
Target Start/End: Original strand, 14803566 - 14803788
Alignment:
| Q |
43 |
attttaccattcaatagtttgcttgtgatatataatttgtaagagattccttttattgagtagaccatacattgagtgcatctattaagaagcatgaata |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14803566 |
attttaccattcaatagtttgcttgtgatatataatttgtaagagattccttttattgagtagaccttacattgagtgcatctattaagaagcatgaata |
14803665 |
T |
 |
| Q |
143 |
ttatgtactattatatgttttagttttttataattagtagcaaggtaaaaaacagtttgaattattggatattatatgtcacgaaaaaatacattcattt |
242 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14803666 |
ttatgtactattatatgttttggttttttataattagtagcaaggtaaaaaacagtttgaattattggatattatatgtcacgaaaaaatacattcattt |
14803765 |
T |
 |
| Q |
243 |
cactaagagaaactttcattaac |
265 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
14803766 |
cactaagagaaactttcattaac |
14803788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University