View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0323_high_11 (Length: 313)
Name: NF0323_high_11
Description: NF0323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0323_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 4 - 289
Target Start/End: Original strand, 47178476 - 47178760
Alignment:
Q |
4 |
aaattacttcaaagaaattgatccaatgtagtttttccattggatgatttgatcatttgagacgttgaccaaataaaccaaatttatt----ggtgattt |
99 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
47178476 |
aaattacttcaaagaaattgatccaatgtagtttttccattggatgatttgatcatttgagacgttgaccaaataaaccaaatttattaattggtgattt |
47178575 |
T |
 |
Q |
100 |
tcttggcttctaacaatgattttcatggattcggattcacggctgtcataaaaaacctgcggtcacctaatatatatccaccctatgatgaatccagcgc |
199 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||||||||| |
|
|
T |
47178576 |
tcttcgcttctaacaatgattttcatggattcggattcacggctgtcataaaaa-cctgcagtcacctaatat----ccaccctatgatgaatccagcgc |
47178670 |
T |
 |
Q |
200 |
tccatatcatttccatcttaactactaaatgaaaaatcgcaaaatgctagctgatggcaaagctcaaccattgtggtgttggtggtgatg |
289 |
Q |
|
|
||||||||||||||||| |||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47178671 |
tccatatcatttccatcctaactaataaatgaaaaatcggaaaatgctagctgatggcaaagctcaaccattgtggtgttggtggtgatg |
47178760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 173 - 207
Target Start/End: Complemental strand, 47179050 - 47179016
Alignment:
Q |
173 |
atatccaccctatgatgaatccagcgctccatatc |
207 |
Q |
|
|
||||| ||||||||||||||||||||||||||||| |
|
|
T |
47179050 |
atatctaccctatgatgaatccagcgctccatatc |
47179016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University