View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0323_low_25 (Length: 246)
Name: NF0323_low_25
Description: NF0323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0323_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 38568968 - 38569124
Alignment:
| Q |
1 |
acgctagactacgacaaaaagagaaatcattcattaacgaatataatttcgtagcatggttttatgttaccttggtcacttggtcaacaatgtcctcggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38568968 |
acgctagactacgacaaaaagagaaatcattcattaacgaatataatttcgtagcatggttttatgttaccttggtcacttggtcaacaatgtcctcggt |
38569067 |
T |
|
| Q |
101 |
gttagtttggttactaccgaaactatgaatcatttgaccgaggagcactgtgatgat |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38569068 |
gttagtttggttactaccgaaactatgaatcatttgaccgaggagcactgtcatgat |
38569124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 61 - 141
Target Start/End: Original strand, 38527615 - 38527695
Alignment:
| Q |
61 |
tttatgttaccttggtcacttggtcaacaatgtcctcggtgttagtttggttactaccgaaactatgaatcatttgaccga |
141 |
Q |
| |
|
|||||| |||||||| |||||| || |||| || ||||||| ||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
38527615 |
tttatgataccttggacacttgttctacaacatcggtggtgttactttggttactaccaaaactatcaatcatttgaccga |
38527695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University