View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0323_low_4 (Length: 420)
Name: NF0323_low_4
Description: NF0323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0323_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 13 - 299
Target Start/End: Original strand, 47718827 - 47719113
Alignment:
| Q |
13 |
gagacagggagcgaatggtgccgaaaacttggacggaaaggattgattgaatgcggccaaatttgtcggggcgaagaagttcgagaaccttgcctctggc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47718827 |
gagacagggagcgaatggtgccgaaaacttggacggaaaggattgattgaatgcggccaaatttgtcggggcgaagaagttcgagaaccttgcctctggc |
47718926 |
T |
|
| Q |
113 |
gacgacgatttcttgggttttaccgtcatcggagccggagaagtttccgttgattgcacagacaatgccggtgggtcgttgcagagtgagattgtagaga |
212 |
Q |
| |
|
|||||||||||||||||| ||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47718927 |
gacgacgatttcttgggtaataccgtcgtctgagccggagaagttgccgttgattgcacagacaatgccggtgggtcgttgcagagtgagattgtagaga |
47719026 |
T |
|
| Q |
213 |
tacatggctatgacaaagcgatgcacagaagggtttagggttttagcgatttcgatatggtaattgtgaagggtttacggttatagc |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47719027 |
tacatggctatgacaaagcgatgcacagaagggtttagggttttagagatttcgatatggtaattgtgaagggtttacggttatagc |
47719113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 13 - 299
Target Start/End: Complemental strand, 47855256 - 47854970
Alignment:
| Q |
13 |
gagacagggagcgaatggtgccgaaaacttggacggaaaggattgattgaatgcggccaaatttgtcggggcgaagaagttcgagaaccttgcctctggc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47855256 |
gagacagggagcgaatggtgccgaaaacttggacggaaaggattgattgaatgcggccaaatttgtcggggcgaagaagttcgagaaccttgcctctggc |
47855157 |
T |
|
| Q |
113 |
gacgacgatttcttgggttttaccgtcatcggagccggagaagtttccgttgattgcacagacaatgccggtgggtcgttgcagagtgagattgtagaga |
212 |
Q |
| |
|
|||||||||||||||||| ||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47855156 |
gacgacgatttcttgggtaataccgtcgtctgagccggagaagttgccgttgattgcacagacaatgccggtgggtcgttgcagagtgagattgtagaga |
47855057 |
T |
|
| Q |
213 |
tacatggctatgacaaagcgatgcacagaagggtttagggttttagcgatttcgatatggtaattgtgaagggtttacggttatagc |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47855056 |
tacatggctatgacaaagcgatgcacagaagggtttagggttttagagatttcgatatggtaattgtgaagggtttacggttatagc |
47854970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 146 - 219
Target Start/End: Complemental strand, 52208382 - 52208309
Alignment:
| Q |
146 |
gccggagaagtttccgttgattgcacagacaatgccggtgggtcgttgcagagtgagattgtagagatacatgg |
219 |
Q |
| |
|
|||||||||||| |||||||| ||||||| || |||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
52208382 |
gccggagaagttgccgttgatggcacagatgattccggtgggtcgttgaagagtgagattgtaaagatacatgg |
52208309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University