View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0324_low_5 (Length: 239)
Name: NF0324_low_5
Description: NF0324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0324_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 65 - 126
Target Start/End: Original strand, 15559753 - 15559814
Alignment:
| Q |
65 |
acaacgcgttgttatgatggtgctgttgctggtggttatgcctctctcactctttctctctg |
126 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15559753 |
acaacgcgttgttatgatgttgttgttgctggtggttatgcctctctcactctttctctctg |
15559814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University