View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0325_low_1 (Length: 476)
Name: NF0325_low_1
Description: NF0325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0325_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 1e-91; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 198 - 455
Target Start/End: Complemental strand, 8288127 - 8287864
Alignment:
Q |
198 |
ttacataaatgcccttgccacattagggtgtatgttaaaggtatggagaaaaaggttgtcaatgaaacattactctttt------ttatggataattagt |
291 |
Q |
|
|
||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
8288127 |
ttacataaacgcccctgccacattggggtgtatgttaaaggtatggagaaaaaggttgtcaatgaaacattactcttttatttttttatggataattagt |
8288028 |
T |
 |
Q |
292 |
tatagacccttataatatacaccctcatgtggaaatttgaattnnnnnnnnnnnnn-ttatctctcctctcaaaccttatatatgcgttctctgtcatct |
390 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8288027 |
tatagacc-ttataatatacaccctcatgtggaaatttgaattaaaaaaataaaaaattatctctcctctcaaaccttatatatgcgttctctgtcatct |
8287929 |
T |
 |
Q |
391 |
ctctttctcaactctgatttcactttcccacctgagctttctgtttctgtttcctaatgatgatg |
455 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
8287928 |
ctctttctcaactctgatttcactttcccacctgagctttctgtttttgtttcctaatgatgatg |
8287864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 9 - 102
Target Start/End: Complemental strand, 8288310 - 8288217
Alignment:
Q |
9 |
gagatgaagagaggatagggcagagggagggatgaggcgatgatggtggtgggagagggaatgtggttgaaggggaagggagtcgcaagagaga |
102 |
Q |
|
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
T |
8288310 |
gagatgaagagagggtagtgcagagggagggatgaggcgatgatggtggtgggagagggaatttggtcgaaggggaagggagtcgcaagagaga |
8288217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 10 - 60
Target Start/End: Complemental strand, 1175382 - 1175332
Alignment:
Q |
10 |
agatgaagagaggatagggcagagggagggatgaggcgatgatggtggtgg |
60 |
Q |
|
|
||||||||||||| ||||||||||||| |||||||| | | |||||||||| |
|
|
T |
1175382 |
agatgaagagagggtagggcagagggaaggatgaggtgttaatggtggtgg |
1175332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University