View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0325_low_2 (Length: 349)
Name: NF0325_low_2
Description: NF0325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0325_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 116 - 341
Target Start/End: Complemental strand, 26798622 - 26798397
Alignment:
Q |
116 |
ttcatcatcatcatcgatgcagtttctcatccttgaacaagttcaattcgtgaaagtgaatgatgattctcttcttcaatgggaacttgttgatgttgtt |
215 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26798622 |
ttcatcatcatcatcgatgcagtttctcatccttgaacaagttcaattcgtgaaagtgaatgatgattctcttcttcaatgggaacttgttgatgttgtt |
26798523 |
T |
 |
Q |
216 |
gacgctgaagaacaatcagaagaagaagaaagggttgatgatgatggtgattctttcatttcttggtcagattcttctagaatcggtgacccaattgaac |
315 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
26798522 |
gacgctgaagaacaatcagaagaagaagaaagggttgatgatgatggtgattctttcatttcttggtcagattcttctagaatcggtgacccgattgaac |
26798423 |
T |
 |
Q |
316 |
tattaacccatcgccgtattcatctc |
341 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
26798422 |
tattaacccatcgccgtattcatctc |
26798397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 472 times since January 2019
Visitors: 2766