View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0327_low_5 (Length: 326)
Name: NF0327_low_5
Description: NF0327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0327_low_5 |
 |  |
|
[»] scaffold0219 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 13 - 184
Target Start/End: Original strand, 38423871 - 38424042
Alignment:
Q |
13 |
aaaatcacaacatagaggttaataaatatgactatattcaagtgtgcagaatacttatgtctccacctataatgttgagaatatcaaagtcaataatttg |
112 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
38423871 |
aaaatcacaacatagaggttaataaatatgactatattcaagtgtgcagaatacttatgtctccacctataatgttgagaatgtcaaagtcaataatttg |
38423970 |
T |
 |
Q |
113 |
atttgcaccgtatcaaaatcaatctttcaatttaaataaaatgagcattgcatcaagatcgaaaaagaaggg |
184 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38423971 |
atttgcaccgtatcaaaatcaatctttcaatttaaataaaatgagcattgcatcaagatcgaaaaagaaggg |
38424042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 36 - 77
Target Start/End: Original strand, 32778782 - 32778823
Alignment:
Q |
36 |
aaatatgactatattcaagtgtgcagaatacttatgtctcca |
77 |
Q |
|
|
|||||||||||||||||||| | ||||||||| ||||||||| |
|
|
T |
32778782 |
aaatatgactatattcaagtctccagaatactcatgtctcca |
32778823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 36 - 76
Target Start/End: Complemental strand, 21280 - 21240
Alignment:
Q |
36 |
aaatatgactatattcaagtgtgcagaatacttatgtctcc |
76 |
Q |
|
|
|||||||||||||||||||| | ||||||||| |||||||| |
|
|
T |
21280 |
aaatatgactatattcaagtctccagaatactcatgtctcc |
21240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University