View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0328_high_3 (Length: 267)
Name: NF0328_high_3
Description: NF0328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0328_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 71 - 243
Target Start/End: Original strand, 23523087 - 23523259
Alignment:
| Q |
71 |
ccttcttatccaacatggaacacaaactcaactaggttctataaccatccaacaacttcttcttactctcaacaacaacctatcaatggtagtcctttag |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23523087 |
ccttcttatccaacatggaacacaaactcaactaggttctataaccatccaacaacttcttcttactctcaacaacaacctatcaatggtagtcctttag |
23523186 |
T |
 |
| Q |
171 |
ctttttggcgtatcccaaatggcacagttcagagtaaccctagtttcaaccatgaacgtcctttacctttgct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23523187 |
ctttttggcgtatcccaaatggcacagttcagagtaaccctagtttcaaccatgaacgtcctttacctttgct |
23523259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University