View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0328_high_7 (Length: 250)
Name: NF0328_high_7
Description: NF0328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0328_high_7 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 21 - 250
Target Start/End: Complemental strand, 8845389 - 8845160
Alignment:
| Q |
21 |
acatcatcatcatataaatatcataatggtagataaaccattattttattgaacataagagattaacaagagttaagaaagaaaaagtacagacaaaaat |
120 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8845389 |
acatcatcatcatataaatatcatgatggtagataaaccattattttattgaacataagagattaacaagagttaagaaagaaaaagtacagacaaaaat |
8845290 |
T |
|
| Q |
121 |
gaacccacagaccttataagtacatcagacagggcatttgggccagctggaacatgaacgatatggctcgtatcattattgttcacagctgcaacaagag |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
8845289 |
gaacccacagaccttataagtacatcagacagagcatttgggccagctggaacatgaacgatatggctcgtatcattattgttcacagctgcaacaagtg |
8845190 |
T |
|
| Q |
221 |
cttccagcttctcagtatttgcttcatctt |
250 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |
|
|
| T |
8845189 |
cttccagcttctcagtctttgcttcatctt |
8845160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 113 - 233
Target Start/End: Original strand, 31883796 - 31883916
Alignment:
| Q |
113 |
acaaaaatgaacccacagaccttataagtacatcagacagggcatttgggccagctggaacatgaacgatatggctcgtatcattattgttcacagctgc |
212 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||| ||||| |||||||| || | |||||||||||| || ||||| ||||||||||||| ||||||| |
|
|
| T |
31883796 |
acaaaattgaacccacaaaccttataagtacatccgacagagcatttggaccgggtggaacatgaaccatgtggctactatcattattgtttacagctgt |
31883895 |
T |
|
| Q |
213 |
aacaagagcttccagcttctc |
233 |
Q |
| |
|
|| || |||||||||||||| |
|
|
| T |
31883896 |
aaggagtgcttccagcttctc |
31883916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University