View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0328_low_11 (Length: 310)
Name: NF0328_low_11
Description: NF0328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0328_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 100 - 285
Target Start/End: Original strand, 44542111 - 44542296
Alignment:
| Q |
100 |
ggtgttctctgtttctgtggttgttatgtcatcttgaggttcatcctctgtttctgtggttgttagtccttctcgaggttcatccttctcttcctctccc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44542111 |
ggtgttctctgtttctgtggttgttatgtcatcttgaggttcatcctctgtttctgtggttgttaggccttctcgaggttcatccttctcttcctctccc |
44542210 |
T |
 |
| Q |
200 |
gaagattcttcagcaactgcgttttcatttgatgatgatgcactttctggatgggagtggtcagagaaggcaatttcctgatgatg |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44542211 |
gaagattcttcagcaactgcgttttcatttgatgatgatgcactttctggatgggagtggtcagagaaggcaatttcttgatgatg |
44542296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University