View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0328_low_15 (Length: 267)

Name: NF0328_low_15
Description: NF0328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0328_low_15
NF0328_low_15
[»] chr1 (1 HSPs)
chr1 (71-243)||(23523087-23523259)


Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 71 - 243
Target Start/End: Original strand, 23523087 - 23523259
Alignment:
71 ccttcttatccaacatggaacacaaactcaactaggttctataaccatccaacaacttcttcttactctcaacaacaacctatcaatggtagtcctttag 170  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23523087 ccttcttatccaacatggaacacaaactcaactaggttctataaccatccaacaacttcttcttactctcaacaacaacctatcaatggtagtcctttag 23523186  T
171 ctttttggcgtatcccaaatggcacagttcagagtaaccctagtttcaaccatgaacgtcctttacctttgct 243  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23523187 ctttttggcgtatcccaaatggcacagttcagagtaaccctagtttcaaccatgaacgtcctttacctttgct 23523259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University