View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0328_low_17 (Length: 251)
Name: NF0328_low_17
Description: NF0328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0328_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 42546772 - 42547002
Alignment:
| Q |
1 |
ctgcaaatagtatgaagatcatatatacgtgtaattagatgtcattttcagcgatatcaaattttggaaccttaactaaccaattggtttgtgccatttc |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42546772 |
ctgcaaatagtatgaacatcatatatacgtgtaattagatgtcactttcagcaatatcaaattttggaaccttaactaaccaattggtttgtgccatttc |
42546871 |
T |
 |
| Q |
101 |
attgccacttaagcttttattaagcacaaaaataagttacagtcaacaaatgagactttgagatgaaactaatacatcacaccaactacaatatttttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42546872 |
attgccacttaagcttttattaagcacaaaaataagttacagtcaacaaatgtgactttgagatgaaactaatacatcacaccaactacaatatttttta |
42546971 |
T |
 |
| Q |
201 |
atttatcagtattattttaaagtgatgatgt |
231 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |
|
|
| T |
42546972 |
atttattagtattattttaaagtgatgatgt |
42547002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University