View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0328_low_18 (Length: 251)
Name: NF0328_low_18
Description: NF0328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0328_low_18 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 9 - 251
Target Start/End: Original strand, 668998 - 669240
Alignment:
| Q |
9 |
agcagagacagtgtgaattgttggccgnnnnnnntcatgtctcgcgaaaaggaagaaaatgctacacttctctgcttcaatttcaaagtgttgtataatt |
108 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
668998 |
agcagagacagtgtgaattgttggccgaaaaaaatcatgtctcgcgaagaggaagaaaatgctacacttctctgcttcaatttcaaagtgttgtataatt |
669097 |
T |
|
| Q |
109 |
gacaaattttgacccataaccccaattttcgtgctgggtctcaacgttctcactctctaattcttcaactaggaccatacccataacctcaatttcttaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
669098 |
gacaaattttgacccataaccccaattttcgtgctgggtctcaacgttctcactctctaattcttcaactgggaccatacccataacctcaatttcttaa |
669197 |
T |
|
| Q |
209 |
agttttgtatttaatttctgggttaaaatttatggaagatgat |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
669198 |
agttttgcgtttaatttctgggttaaaatttatggaagatgat |
669240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University