View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0328_low_20 (Length: 250)
Name: NF0328_low_20
Description: NF0328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0328_low_20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 22 - 250
Target Start/End: Complemental strand, 18551664 - 18551436
Alignment:
| Q |
22 |
catcatcatctacctcaatgtttcgattcctgaggctgcgaatttgaatgctcttcatacgaagaacaatcaagcttatgcaccaaacccttagctggaa |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
18551664 |
catcatcatctacctcaatgtttcgattcctgaggctgcgaatttgaatgcccttcatacgaagaacaatcaagcttatgcaccaaacccttagctgaaa |
18551565 |
T |
 |
| Q |
122 |
tcgaaagaagcaaaaatatggcgatcctaagtactgattccatactctatctctaacactgtttatgctttcctagggcctttaccagattctattatgg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18551564 |
gcgaaagaagcaaaaatatggcgatcctaagtactgattccatactctgtctctaacactatttatgctttcctagggcctttaccagattctactatgg |
18551465 |
T |
 |
| Q |
222 |
cttttgatgacattaagaaaatcttcctt |
250 |
Q |
| |
|
|||||||| |||||||||||||||||||| |
|
|
| T |
18551464 |
cttttgataacattaagaaaatcttcctt |
18551436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University