View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0328_low_24 (Length: 231)
Name: NF0328_low_24
Description: NF0328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0328_low_24 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 21 - 231
Target Start/End: Complemental strand, 8845389 - 8845179
Alignment:
| Q |
21 |
acatcatcatcatataaatatcataatggtagataaaccattattttattgaacataagagattaacaagagttaagaaagaaaaagtacagacaaaaat |
120 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8845389 |
acatcatcatcatataaatatcatgatggtagataaaccattattttattgaacataagagattaacaagagttaagaaagaaaaagtacagacaaaaat |
8845290 |
T |
 |
| Q |
121 |
gaacccacagaccttataagtacatcagacagggcatttgggccagctggaacatgaacgatatggctcgtatcattatttttcacagctgcaacaagtg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8845289 |
gaacccacagaccttataagtacatcagacagagcatttgggccagctggaacatgaacgatatggctcgtatcattattgttcacagctgcaacaagtg |
8845190 |
T |
 |
| Q |
221 |
cttccagcttc |
231 |
Q |
| |
|
||||||||||| |
|
|
| T |
8845189 |
cttccagcttc |
8845179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 113 - 231
Target Start/End: Original strand, 31883796 - 31883914
Alignment:
| Q |
113 |
acaaaaatgaacccacagaccttataagtacatcagacagggcatttgggccagctggaacatgaacgatatggctcgtatcattatttttcacagctgc |
212 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||| ||||| |||||||| || | |||||||||||| || ||||| |||||||||| || ||||||| |
|
|
| T |
31883796 |
acaaaattgaacccacaaaccttataagtacatccgacagagcatttggaccgggtggaacatgaaccatgtggctactatcattattgtttacagctgt |
31883895 |
T |
 |
| Q |
213 |
aacaagtgcttccagcttc |
231 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
31883896 |
aaggagtgcttccagcttc |
31883914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University