View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0328_low_26 (Length: 222)
Name: NF0328_low_26
Description: NF0328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0328_low_26 |
 | |
|
| [»] scaffold0007 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0007 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 6 - 208
Target Start/End: Complemental strand, 270654 - 270452
Alignment:
| Q |
6 |
tgggcgagtgagatgaaggccatggggagtttgaaagataggttgatatttttggaggagtgattgtatgtcttggggaagatctgctgttattgtttct |
105 |
Q |
| |
|
|||||||||| | ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |||||||||| |
|
|
| T |
270654 |
tgggcgagtggggggaaggccattgggagtttgaaagataggttgatatttttggaggagtgattgtatgtcttggggtagatctgttggtattgtttct |
270555 |
T |
|
| Q |
106 |
gtttttggggaatttggttgtggtggctcagtgatggatgaacaagtcagtaaatggagtgaagcgatagagtcggtatgtataaggtggcggatgtgat |
205 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
270554 |
gtttttggggaatgtggttgtggtggctcggtgatggatgaacaagtcagaagatggagtgaagcgatagagtcggtatgtataaggtggcggatgtgat |
270455 |
T |
|
| Q |
206 |
gat |
208 |
Q |
| |
|
||| |
|
|
| T |
270454 |
gat |
270452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 6 - 208
Target Start/End: Complemental strand, 9093810 - 9093607
Alignment:
| Q |
6 |
tgggcgagtgagatgaaggccatggggagtttgaaagataggttgatatttttggaggagtgattgtatgtcttggggaagatctgctgttattgtttct |
105 |
Q |
| |
|
|||||||||| | ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |||||||||| |
|
|
| T |
9093810 |
tgggcgagtggggggaaggccattgggagtttgaaagataggttgatatttttggaggagtgattgtatgtcttggggtagatctgttggtattgtttct |
9093711 |
T |
|
| Q |
106 |
gt-ttttggggaatttggttgtggtggctcagtgatggatgaacaagtcagtaaatggagtgaagcgatagagtcggtatgtataaggtggcggatgtga |
204 |
Q |
| |
|
|| ||||||||||| ||||||||||||||| |||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9093710 |
gtattttggggaatgtggttgtggtggctcggtgatggatgaacaagtcagcagatggagtgaagcgatagagtcggtatgtataaggtggcggatgtga |
9093611 |
T |
|
| Q |
205 |
tgat |
208 |
Q |
| |
|
|||| |
|
|
| T |
9093610 |
tgat |
9093607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University