View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0329_high_7 (Length: 264)
Name: NF0329_high_7
Description: NF0329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0329_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 38314693 - 38314758
Alignment:
| Q |
1 |
tttttacttgccacactcttctaatcttaatttttgtttaatacatttcacttcttatgactaatt |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38314693 |
tttttacttgccacactcttctaatcttaatttttgtttaatacatttcactttttatgactaatt |
38314758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 207
Target Start/End: Complemental strand, 36846933 - 36846858
Alignment:
| Q |
129 |
ttcttttattatttggctaatgtaagttcactagcagcagaagcattgaagaagttccccattggagattgattatgat |
207 |
Q |
| |
|
||||||| |||||||||| |||| |||||||||||| |||||||| ||| |||||| |||||||||||||||||| |
|
|
| T |
36846933 |
ttcttttcttatttggctctggtaatttcactagcagcggaagcattcaag---ttccccgttggagattgattatgat |
36846858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University