View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0329_low_12 (Length: 331)
Name: NF0329_low_12
Description: NF0329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0329_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 96 - 254
Target Start/End: Complemental strand, 7012395 - 7012237
Alignment:
| Q |
96 |
acatgcaagtatggaacaagggtggattatattttgggttcatcaaaatcaccatacaaatttgttccagggtcatactcagtaatttcttctaaaggaa |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7012395 |
acatgcaagtatggaacaagggtggattatattttgggttcatcaaaatcaccatacaaatttgttccagggtcatactcagtaatttcttctaaaggaa |
7012296 |
T |
 |
| Q |
196 |
cttctgatcaccacattgtgaaggtagatataatgaaagtaaatacttcaactcagaat |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7012295 |
cttctgatcaccacattgtgaaggtagatataatgaaagtaaatacttcaactcagaat |
7012237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University