View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0329_low_19 (Length: 298)
Name: NF0329_low_19
Description: NF0329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0329_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 59 - 221
Target Start/End: Original strand, 32725916 - 32726078
Alignment:
| Q |
59 |
gatgaaaagaaaatggttgtccgagggaagcggcaaaggaggttaatcgcctgccggtttcttgtacggtggcgattgacctccggccggttcctgtccg |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32725916 |
gatgaaaagaaaatggttgtccgagggaagcggcaaaggaggttaatcgcctgccggtttcttgtacggtggcgattgacctccggccggttcctgtccg |
32726015 |
T |
|
| Q |
159 |
cgataatgcggttatccgaagatgtggaccgttgttgttggaagcaagtgattggattaatga |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726016 |
cgataatgcggttatccgaagatgtggaccgttgttgttggaagcaagtgattggattaatga |
32726078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University