View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0329_low_20 (Length: 289)
Name: NF0329_low_20
Description: NF0329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0329_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 1e-84; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 66 - 236
Target Start/End: Complemental strand, 36531793 - 36531623
Alignment:
| Q |
66 |
attagcacatgttttcatacacgaaggatacgacggcacaaaagtgtctgcacatccactaccaacggatgttccaccattacttttacagactggtttt |
165 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36531793 |
attagcacatgttttcatacatgaaggatacgacggcacaaaagtgtctgcacatccactactaacggatgttccaccattacttttacaggctggtttt |
36531694 |
T |
|
| Q |
166 |
ggtggatcctgcgttggaacctttttcggggcaccaaactgtacgaatgatgggaaagtctgtggattcat |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36531693 |
ggtggatcctgcgttggaacctttttcggggcaccaaactgtacgaatgatgggaaagtctgtggattcat |
36531623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 76 - 219
Target Start/End: Original strand, 26305628 - 26305771
Alignment:
| Q |
76 |
gttttcatacacgaaggatacgacggcacaaaagtgtctgcacatccactaccaacggatgttccaccattacttttacagactggttttggtggatcct |
175 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||||| |||||| ||| || ||||| || | |||||||||||||||| || | | |||||||||| ||| |
|
|
| T |
26305628 |
gttttcatacatgaaggatatgactgcacaaaagcatctgcatatctaccaccaaggggttttccaccattacttttggaggccgcttttggtggagcct |
26305727 |
T |
|
| Q |
176 |
gcgttggaacctttttcggggcaccaaactgtacgaatgatggg |
219 |
Q |
| |
|
|| | ||| | |||||| |||||| |||| |||| ||||||||| |
|
|
| T |
26305728 |
gcatgggagcatttttccgggcacgaaaccgtacaaatgatggg |
26305771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 137 - 203
Target Start/End: Complemental strand, 36525396 - 36525330
Alignment:
| Q |
137 |
ttccaccattacttttacagactggttttggtggatcctgcgttggaacctttttcggggcaccaaa |
203 |
Q |
| |
|
|||||| |||||||||| || || ||||||| ||| ||||| || || ||||||||||||||||||| |
|
|
| T |
36525396 |
ttccacgattacttttagaggctagttttggcggagcctgcattcgagcctttttcggggcaccaaa |
36525330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University