View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0329_low_27 (Length: 267)
Name: NF0329_low_27
Description: NF0329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0329_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 20 - 256
Target Start/End: Original strand, 43415351 - 43415587
Alignment:
Q |
20 |
acatcatcataatcataatcaacaactaggggtttctgcaataaagatgaagaaaatgaagggaagaagaaaggtgagggagcctaggttttgcttcaag |
119 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43415351 |
acatcatcatcatcataatcaacaactaggggtttctgcaataaagatgaagaaaatgaagggaagaagaaaggtgagggagcctaggttttgcttcaag |
43415450 |
T |
 |
Q |
120 |
actatgagcgacgtggatgtgttggatgatggttacaagtggaggaagtacggacagaaagtggtcaagaacacacagcatccaaggtattttctctctt |
219 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43415451 |
actatgagcgacgtggatgtgttggacgatggttacaagtggaggaagtacggacagaaagtggtcaagaacacacagcatccaaggtattttctctctt |
43415550 |
T |
 |
Q |
220 |
tttaattatttaatttgtttgtctttatgctctctct |
256 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
43415551 |
tttaattatttaatttgtttgtctttatgctctctct |
43415587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 66 - 209
Target Start/End: Complemental strand, 38496149 - 38496003
Alignment:
Q |
66 |
atgaagaaaatgaagggaagaagaaaggtgagggagcctaggttttgcttcaagactatgagc---gacgtggatgtgttggatgatggttacaagtgga |
162 |
Q |
|
|
|||||||||||||||||||||| || ||||| |||||||||||||||||||| || |||| || ||||||||||||||||||||||||||||||| |
|
|
T |
38496149 |
atgaagaaaatgaagggaagaaagaaagtgagagagcctaggttttgcttcaaaacattgagtactgatgtggatgtgttggatgatggttacaagtgga |
38496050 |
T |
 |
Q |
163 |
ggaagtacggacagaaagtggtcaagaacacacagcatccaaggtat |
209 |
Q |
|
|
||||||| ||||| ||||| || |||||||| || ||||| |||||| |
|
|
T |
38496049 |
ggaagtatggacaaaaagttgtaaagaacacccaacatcccaggtat |
38496003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University