View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0329_low_28 (Length: 266)
Name: NF0329_low_28
Description: NF0329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0329_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 25 - 229
Target Start/End: Complemental strand, 8324368 - 8324164
Alignment:
| Q |
25 |
gtgagatgaagagaaaattaccaagggagaaaggaccgattccgagaccgggacgaagatcaagaacgatagcgcccatggctgtgccttcgcaacggcg |
124 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8324368 |
gtgaaatgaagagaaaattaccgagggagaaaggaccgattccgagaccgggacgaagatcaagaacgatagcgcccatggctgtgccttcgcaacggcg |
8324269 |
T |
|
| Q |
125 |
tctgggtttctgcaacatagtcggggaagttggagggtattttagagatttctgggttggaattccgttactatcggagatgaaagtacttcaagatgat |
224 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8324268 |
tctgggtctctgcaacatagtcggggaagttggagggtattttagagatttctgggttggaattccgttactatcggagatgaaagtacttcaagatgat |
8324169 |
T |
|
| Q |
225 |
gatgt |
229 |
Q |
| |
|
||||| |
|
|
| T |
8324168 |
gatgt |
8324164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University