View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0329_low_30 (Length: 264)

Name: NF0329_low_30
Description: NF0329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0329_low_30
NF0329_low_30
[»] chr5 (1 HSPs)
chr5 (1-66)||(38314693-38314758)
[»] chr8 (1 HSPs)
chr8 (129-207)||(36846858-36846933)


Alignment Details
Target: chr5 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 38314693 - 38314758
Alignment:
1 tttttacttgccacactcttctaatcttaatttttgtttaatacatttcacttcttatgactaatt 66  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
38314693 tttttacttgccacactcttctaatcttaatttttgtttaatacatttcactttttatgactaatt 38314758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 207
Target Start/End: Complemental strand, 36846933 - 36846858
Alignment:
129 ttcttttattatttggctaatgtaagttcactagcagcagaagcattgaagaagttccccattggagattgattatgat 207  Q
    ||||||| ||||||||||   |||| |||||||||||| |||||||| |||   |||||| ||||||||||||||||||    
36846933 ttcttttcttatttggctctggtaatttcactagcagcggaagcattcaag---ttccccgttggagattgattatgat 36846858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University