View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0329_low_32 (Length: 257)
Name: NF0329_low_32
Description: NF0329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0329_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 19148712 - 19148878
Alignment:
| Q |
1 |
atgaatgagaactgttattgcagattcggcgggacaagaggatgagcttgcaaagggtgtttttctttttcctgacagaattaaattcttgnnnnnnnct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
19148712 |
atgaatgagaactgttattgcagattcggcgggacaagaggatgagcttgcaaagggtgtttttctttttcctgacagaattaaattcttgtttttttct |
19148811 |
T |
 |
| Q |
101 |
gtttgttcaatctcaaaaacactaacaatcattaactaccgcttaagtttgattaatataattttaa |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19148812 |
gtttgttcaatctcaaaaacactaacaatcattaactaccgcttaagtttgattaatacaattttaa |
19148878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University