View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0329_low_33 (Length: 255)
Name: NF0329_low_33
Description: NF0329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0329_low_33 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 131 - 255
Target Start/End: Original strand, 38314468 - 38314592
Alignment:
| Q |
131 |
tatttttctgtgaaagattcctcaatcccccataattcaaattcaaattgtatcaagttcttccctctctactttttaaaatttgaatctctcaaaccct |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38314468 |
tatttttctgtgaaagattcctcaatcccccataattcaaattcaaattgtatcaagttcttccctctctactttttaaaatttgaatctctcaaaccct |
38314567 |
T |
 |
| Q |
231 |
tatctcattccagtctcttttcttc |
255 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
38314568 |
tatctcattccagtctcttttcttc |
38314592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 6 - 133
Target Start/End: Complemental strand, 45479646 - 45479519
Alignment:
| Q |
6 |
agcagcagagagcatcttttccatacattctatatttgacctactgctacttttttaggaatctttctttatactccttcaaaactgtacaacaaaaaca |
105 |
Q |
| |
|
||||||||||| |||||||| |||||||| ||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45479646 |
agcagcagagatcatctttttcatacattttatatttgagctactgctactttttcaggaatctttctttatactccttcaaaactgtacaacaaaaaca |
45479547 |
T |
 |
| Q |
106 |
ggttgtatgattcctcaacttcacctat |
133 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
45479546 |
ggttgtatgattcctcaacttcacctat |
45479519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University