View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0329_low_39 (Length: 219)

Name: NF0329_low_39
Description: NF0329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0329_low_39
NF0329_low_39
[»] chr4 (1 HSPs)
chr4 (1-141)||(54702966-54703106)


Alignment Details
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 54702966 - 54703106
Alignment:
1 ctccgttattatccctttctcacctactgtcatctctctgtcgccggccgctgcgnnnnnnngggttcaagatccgtgcttctttctctgaccgtcgtct 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||        ||||||||||||||||||||||||| || |||| ||||    
54702966 ctccgttattatccctttctcacctactgtcatctctctgtcgccgaccgctgcatttttttgggttcaagatccgtgcttctttctttggccgttgtct 54703065  T
101 tttttgagagaataatgaccggagaggaaaacgatgatgat 141  Q
    |||||||||||||||||||||||||||||||||||| ||||    
54703066 tttttgagagaataatgaccggagaggaaaacgatggtgat 54703106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University