View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0329_low_39 (Length: 219)
Name: NF0329_low_39
Description: NF0329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0329_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 54702966 - 54703106
Alignment:
| Q |
1 |
ctccgttattatccctttctcacctactgtcatctctctgtcgccggccgctgcgnnnnnnngggttcaagatccgtgcttctttctctgaccgtcgtct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| || |||| |||| |
|
|
| T |
54702966 |
ctccgttattatccctttctcacctactgtcatctctctgtcgccgaccgctgcatttttttgggttcaagatccgtgcttctttctttggccgttgtct |
54703065 |
T |
 |
| Q |
101 |
tttttgagagaataatgaccggagaggaaaacgatgatgat |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
54703066 |
tttttgagagaataatgaccggagaggaaaacgatggtgat |
54703106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University