View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0329_low_9 (Length: 332)
Name: NF0329_low_9
Description: NF0329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0329_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 7e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 23 - 186
Target Start/End: Original strand, 30693281 - 30693444
Alignment:
Q |
23 |
atgaacggggagaatggatgggaattcggaagcagggagattcttggaagaccaatcgaaggcgagggttaggttttggatccattcgatggttagtttt |
122 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30693281 |
atgaacggggagaatggatgggaattcggaagcagggagattcttggaagaccaatcgaaggcgagggttaggttttggatccattcgatggttagtttt |
30693380 |
T |
 |
Q |
123 |
gcgtcttctggccaggatatcgggagttggagttctggtggtggcggtgaggaggaagatgatt |
186 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
30693381 |
gcgtcttctggccaggatatcgggagttggagttctggtggtggtgatgaggaggaagatgatt |
30693444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University