View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0331-INSERTION-2 (Length: 539)
Name: NF0331-INSERTION-2
Description: NF0331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0331-INSERTION-2 |
 |  |
|
[»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 465; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 465; E-Value: 0
Query Start/End: Original strand, 8 - 539
Target Start/End: Complemental strand, 19148564 - 19148022
Alignment:
Q |
8 |
ttcttttccttcaattgattaatgcattttcttcctggcagaaaatgataattgaagaaatgggtcatacttggaatttattttggaatcttatatatca |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19148564 |
ttcttttccttcaattgattaatgcattttcttcctggcagaaaatgataattgaagaaatgggtcatacttggaatttattttggaatcttatatatca |
19148465 |
T |
 |
Q |
108 |
tgttattttttgaaaggctcttattgttgatattgattatgatgtgccagagatatctagcatctctggcatgtgtgtagttaccttagtgtcgtgtctg |
207 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19148464 |
agttattttttgaaaggctcttgttgttgatattgattatgacgtgccagagatatctagcatctctggcatgtgtgtagttaccttagtgtcgtgtctg |
19148365 |
T |
 |
Q |
208 |
gtgcccgtgtctgtggcataattacatggtgtgtctggtgtccgtgtctatctgatattaggacacatgtgtagttaaattcaattacttttacttaatt |
307 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
T |
19148364 |
gtgcccgtgtctgtggcataattacatggtgtgtctggtgtccgtgtctatctgatattatgacacatgtgtagttaaactcaattacttttacttaatt |
19148265 |
T |
 |
Q |
308 |
aaattatttgaggtttttatg-----------tgtcggtgtttaataggttagggtaatctgtttaactgatgtgtgaattttggattgtttgtgttgtt |
396 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19148264 |
aaattatttgaggtttttatgtgtcagtgttgtgtcggtgtttaataggttagggtaatctgtttaactgatgtgtgaattttggattgtttgtgttgtt |
19148165 |
T |
 |
Q |
397 |
acattacagtgattgtggaacttggaaggagatttcttattgttgagtttgattatggtctatgtagcaccgacgctttagataaatggcgtgttagata |
496 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
T |
19148164 |
acattacagtgattgtagaacttggaaggagatttcttattgttgagtttgattatggtctatgtatcatcgacgctttagataaatggcgtgttagata |
19148065 |
T |
 |
Q |
497 |
tctgacgtgcacatagttacattcggtgttgtgtctggtgtct |
539 |
Q |
|
|
|||||| ||| |||||||||||||||||||||||||||||||| |
|
|
T |
19148064 |
tctgacatgcgcatagttacattcggtgttgtgtctggtgtct |
19148022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 359 - 425
Target Start/End: Complemental strand, 19147920 - 19147852
Alignment:
Q |
359 |
tttaactgatgtgtgaattttggattgttt--gtgttgttacattacagtgattgtggaacttggaagg |
425 |
Q |
|
|
|||| ||||| ||||| ||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
T |
19147920 |
tttagctgatttgtgagttttggattgtttatgtgttgttacattacagcgattgtggaacttggaagg |
19147852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1975 times since January 2019
Visitors: 2874